Sequence retrieval

Genome: Bordetella petrii
Start position: 3559813
End position: 3559836
Length: 24

DNA sequence
>NC_010170, from 3559813 to 3559836 (24 bp); Bordetella petrii GCCCGCGCGCGCGCCCTCGCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3559502-3559999	Sequence	Bpet3381 tadG1 Flp pilus assembly protein (Protein is coded in complementary strand; from 3559999 to 3559502)