Sequence retrieval

Genome: Bordetella petrii
Start position: 3197301
End position: 3197348
Length: 48

DNA sequence
>NC_010170, from 3197301 to 3197348 (48 bp); Bordetella petrii ACTGACCTGCCCGCGAATCGACCTACCCGCGAATCGACCTGCCCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3195459-3197306	Sequence	Bpet3048 - sulfite reductase (NADPH) flavoprotein alpha-component