Sequence retrieval

Genome: Bordetella petrii
Start position: 3184036
End position: 3184062
Length: 27

DNA sequence
>NC_010170, from 3184036 to 3184062 (27 bp); Bordetella petrii CGGCCACGGCGGCCGCGGCGGCCATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3184005-3185408	Sequence	Bpet3037 leuC2 isopropylmalate isomerase large subunit (Protein is coded in complementary strand; from 3185408 to 3184005)