Sequence retrieval

Genome: Bordetella petrii
Start position: 2996026
End position: 2996049
Length: 24

DNA sequence
>NC_010170, from 2996026 to 2996049 (24 bp); Bordetella petrii GATGGCGGTGGCGATGGTGATGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2995817-2996695	Sequence	Bpet2850 - ABC transporter inner membrane protein (Protein is coded in complementary strand; from 2996695 to 2995817)