Sequence retrieval

Genome: Bordetella petrii
Start position: 2990718
End position: 2990771
Length: 54

DNA sequence
>NC_010170, from 2990718 to 2990771 (54 bp); Bordetella petrii GCACCGGTAGTGCCTGCTGCACCGGTAGTGCCTGCTGCACCGGTACTGCCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2990283-2991977	Sequence	Bpet2847 - hypothetical protein (Protein is coded in complementary strand; from 2991977 to 2990283)