Sequence retrieval

Genome: Bordetella petrii
Start position: 2954095
End position: 2954139
Length: 45

DNA sequence
>NC_010170, from 2954095 to 2954139 (45 bp); Bordetella petrii CGCCGGCCGCTGCATCGACCGCTGCTGCATCGACCGCTGCTGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2954010-2955680	Sequence	Bpet2811 - methyltransferase (Protein is coded in complementary strand; from 2955680 to 2954010)