Sequence retrieval

Genome: Bordetella petrii
Start position: 2931583
End position: 2931606
Length: 24

DNA sequence
>NC_010170, from 2931583 to 2931606 (24 bp); Bordetella petrii CCGGCGCCGGGGCCTGCGCCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2930868-2933324	Sequence	Bpet2789 lon ATP-dependent protease La (Protein is coded in complementary strand; from 2933324 to 2930868)