Sequence retrieval

Genome: Bordetella petrii
Start position: 2828147
End position: 2828170
Length: 24

DNA sequence
>NC_010170, from 2828147 to 2828170 (24 bp); Bordetella petrii TTGGGCTTTGGCTTTGGCTTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2827751-2828563	Sequence	Bpet2695 tonB siderophore-mediated iron transport protein (Protein is coded in complementary strand; from 2828563 to 2827751)