Sequence retrieval

Genome: Bordetella petrii
Start position: 2687873
End position: 2687896
Length: 24

DNA sequence
>NC_010170, from 2687873 to 2687896 (24 bp); Bordetella petrii AGCGCCAGGGCCAGCCCCAGCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2687507-2687983	Sequence	Bpet2571 - monovalent cation/H+ antiporter subunit E (Protein is coded in complementary strand; from 2687983 to 2687507)