Sequence retrieval

Genome: Bordetella petrii
Start position: 2655689
End position: 2655718
Length: 30

DNA sequence
>NC_010170, from 2655689 to 2655718 (30 bp); Bordetella petrii GGCGCGCCGCGGCGTCGCGCAGCGCGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2655652-2657145	Sequence	Bpet2538 pdhD dihydrolipoamide dehydrogenase (Protein is coded in complementary strand; from 2657145 to 2655652)