Sequence retrieval

Genome: Bordetella petrii
Start position: 2631142
End position: 2631168
Length: 27

DNA sequence
>NC_010170, from 2631142 to 2631168 (27 bp); Bordetella petrii CCAGGACGACCAGTACGATCAGGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2630262-2631191	Sequence	Bpet2515 - hypothetical protein (Protein is coded in complementary strand; from 2631191 to 2630262)