Sequence retrieval

Genome: Bordetella petrii
Start position: 2621089
End position: 2621115
Length: 27

DNA sequence
>NC_010170, from 2621089 to 2621115 (27 bp); Bordetella petrii TCGGCGCCCTCGGCGGCCTCGGCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2620327-2621433	Sequence	Bpet2503 holB DNA polymerase III subunit delta' (Protein is coded in complementary strand; from 2621433 to 2620327)