Sequence retrieval

Genome: Bordetella petrii
Start position: 2508140
End position: 2508169
Length: 30

DNA sequence
>NC_010170, from 2508140 to 2508169 (30 bp); Bordetella petrii TTCACGTACGTTCACGTACGTTCAGGTACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2508162-2509178	Sequence	Bpet2395 topI hypothetical protein (Protein is coded in complementary strand; from 2509178 to 2508162)