Sequence retrieval

Genome: Bordetella petrii
Start position: 2463944
End position: 2463988
Length: 45

DNA sequence
>NC_010170, from 2463944 to 2463988 (45 bp); Bordetella petrii GATTCTTGATCTGGCGGTTCTTGGCCTGGCGATGCTTGGCCTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2463191-2463991	Sequence	Bpet2363 - hypothetical protein (Protein is coded in complementary strand; from 2463991 to 2463191)