Sequence retrieval

Genome: Bordetella petrii
Start position: 2329412
End position: 2329435
Length: 24

DNA sequence
>NC_010170, from 2329412 to 2329435 (24 bp); Bordetella petrii CCAGGCCCTGGCCCAGCCGCAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2329078-2331363	Sequence	Bpet2246 spoT guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase (Protein is coded in complementary strand; from 2331363 to 2329078)