Sequence retrieval

Genome: Bordetella petrii
Start position: 2244936
End position: 2244980
Length: 45

DNA sequence
>NC_010170, from 2244936 to 2244980 (45 bp); Bordetella petrii GCCGGGCCGGCGGCGGCCAGGGCGGCGCCGGCCAGGGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2244036-2245001	Sequence	Bpet2159 bug42 hypothetical protein (Protein is coded in complementary strand; from 2245001 to 2244036)