Sequence retrieval

Genome: Bordetella petrii
Start position: 209246
End position: 209269
Length: 24

DNA sequence
>NC_010170, from 209246 to 209269 (24 bp); Bordetella petrii GGCGCTGCCGCTGACGCTGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 205170-209459	Sequence	Bpet0190 - autotransporter (Protein is coded in complementary strand; from 209459 to 205170)