Sequence retrieval

Genome: Bordetella petrii
Start position: 1693964
End position: 1694011
Length: 48

DNA sequence
>NC_010170, from 1693964 to 1694011 (48 bp); Bordetella petrii TTGCCGTTGCCGCTACCGTTGCCGCTACCGTTGCCGTTGCCGTTGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1693601-1694125	Sequence	Bpet1640 - hypothetical protein (Protein is coded in complementary strand; from 1694125 to 1693601)