Sequence retrieval

Genome: Bordetella petrii
Start position: 1687792
End position: 1687815
Length: 24

DNA sequence
>NC_010170, from 1687792 to 1687815 (24 bp); Bordetella petrii GGCGGCGCCGGCGACGGCCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1686869-1687846	Sequence	Bpet1632 bug37 hypothetical protein (Protein is coded in complementary strand; from 1687846 to 1686869)