Sequence retrieval

Genome: Bordetella petrii
Start position: 152493
End position: 152516
Length: 24

DNA sequence
>NC_010170, from 152493 to 152516 (24 bp); Bordetella petrii GGGCCGGGGCGGAGGCCGGAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 152468-153298	Sequence	Bpet0145 - lipoprotein (Protein is coded in complementary strand; from 153298 to 152468)