Sequence retrieval

Genome: Bordetella petrii
Start position: 1401406
End position: 1401429
Length: 24

DNA sequence
>NC_010170, from 1401406 to 1401429 (24 bp); Bordetella petrii CGATGCCGATGGCGGTGCCGATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1400898-1401554	Sequence	Bpet1340 - threonine efflux protein (Protein is coded in complementary strand; from 1401554 to 1400898)