Sequence retrieval

Genome: Bordetella petrii
Start position: 133822
End position: 133845
Length: 24

DNA sequence
>NC_010170, from 133822 to 133845 (24 bp); Bordetella petrii GACCAGGAACAGGCCCAGGAACAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 133778-134632	Sequence	Bpet0120 petC cytochrome C1 precursor (Protein is coded in complementary strand; from 134632 to 133778)