Sequence retrieval

Genome: Salmonella enterica subsp. arizonae serovar 62:z4,z23:--
Start position: 4531977
End position: 4532042
Length: 66

DNA sequence
>NC_010067, from 4531977 to 4532042 (66 bp); Salmonella enterica subsp. arizonae serovar 62:z4,z23:-- TGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4531557-4532408	Sequence	SARI_04629 - nickel/cobalt efflux protein RcnA (Protein is coded in complementary strand; from 4532408 to 4531557)