Sequence retrieval

Genome: Salmonella enterica subsp. arizonae serovar 62:z4,z23:--
Start position: 3260250
End position: 3260276
Length: 27

DNA sequence
>NC_010067, from 3260250 to 3260276 (27 bp); Salmonella enterica subsp. arizonae serovar 62:z4,z23:-- ACATTTTCGACATTTTCGACATTTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3259356-3260300	Sequence	SARI_03355 - hypothetical protein (Protein is coded in complementary strand; from 3260300 to 3259356)