Sequence retrieval

Genome: Salmonella enterica subsp. arizonae serovar 62:z4,z23:--
Start position: 2862929
End position: 2862964
Length: 36

DNA sequence
>NC_010067, from 2862929 to 2862964 (36 bp); Salmonella enterica subsp. arizonae serovar 62:z4,z23:-- TCATTTTCATTTTCATTTTCATTTTCATTTTCATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2862523-2862969	Sequence	SARI_02935 - hypothetical protein (Protein is coded in complementary strand; from 2862969 to 2862523)