Sequence retrieval

Genome: Salmonella enterica subsp. arizonae serovar 62:z4,z23:--
Start position: 2743715
End position: 2743741
Length: 27

DNA sequence
>NC_010067, from 2743715 to 2743741 (27 bp); Salmonella enterica subsp. arizonae serovar 62:z4,z23:-- CGGCAACGTCGGCATCGTCGTCAACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2743128-2744825	Sequence	SARI_02826 - multicopper oxidase (Protein is coded in complementary strand; from 2744825 to 2743128)