Sequence retrieval

Genome: Salmonella enterica subsp. arizonae serovar 62:z4,z23:--
Start position: 2586127
End position: 2586159
Length: 33

DNA sequence
>NC_010067, from 2586127 to 2586159 (33 bp); Salmonella enterica subsp. arizonae serovar 62:z4,z23:-- TACGTTGGACAATCGTTGGACATCCGTTGGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2585657-2586556	Sequence	SARI_02665 - hypothetical protein (Protein is coded in complementary strand; from 2586556 to 2585657)