Sequence retrieval

Genome: Salmonella enterica subsp. arizonae serovar 62:z4,z23:--
Start position: 207303
End position: 207326
Length: 24

DNA sequence
>NC_010067, from 207303 to 207326 (24 bp); Salmonella enterica subsp. arizonae serovar 62:z4,z23:-- ACAGGGACAGGGACAGGGACAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 207012-208169	Sequence	SARI_00225 - hypothetical protein (Protein is coded in complementary strand; from 208169 to 207012)