Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 4789762
End position: 4789824
Length: 63

DNA sequence
>NC_010001, from 4789762 to 4789824 (63 bp); Clostridium phytofermentans ISDg AAGAAGTTATTTGATTCTTCTAATAAGCCATTTGATTTTTCTAATAAATCATTTGATCCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4788544-4789905	Sequence	Cphy_3892 - cell envelope-related transcriptional attenuator (Protein is coded in complementary strand; from 4789905 to 4788544)