Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 932098
End position: 932157
Length: 60

DNA sequence
>NC_010001, from 932098 to 932157 (60 bp); Clostridium phytofermentans ISDg CCGAAGTCATTTCTGCCAAAGTCATTTCTGCCGAAGTCATTTCTGCCAAAGTCATTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 931839-932423	Sequence	Cphy_0718 - hypothetical protein (Protein is coded in complementary strand; from 932423 to 931839)