Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 628031
End position: 628090
Length: 60

DNA sequence
>NC_010001, from 628031 to 628090 (60 bp); Clostridium phytofermentans ISDg AGAAAAGAAAATACTAAAGTAGAAAATACTAAAAAAGAAAGAACTAAAAAAGAAAAAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 627945-630125	Sequence	Cphy_0493 - methyl-accepting chemotaxis sensory transducer