Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3961647
End position: 3961706
Length: 60

DNA sequence
>NC_010001, from 3961647 to 3961706 (60 bp); Clostridium phytofermentans ISDg TCATCATTTTTTGACTCATCATTTCTTGACTCATCATTTCTTGACTCATCTTTTCTTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3961410-3963032	Sequence	Cphy_3257 - hypothetical protein (Protein is coded in complementary strand; from 3963032 to 3961410)