Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 1617912
End position: 1617971
Length: 60

DNA sequence
>NC_010001, from 1617912 to 1617971 (60 bp); Clostridium phytofermentans ISDg TTAGTTCGAAATCCTAGATATTACTTTGAAATCCTAGATATTACTATAAAATCCTAGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1616339-1617916	Sequence	Cphy_1288 - integral membrane sensor signal transduction histidine kinase