Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 1460369
End position: 1460428
Length: 60

DNA sequence
>NC_010001, from 1460369 to 1460428 (60 bp); Clostridium phytofermentans ISDg TACACCAACACCAACATCAACACCAACACCAACGCCTACGACAACACCAACGCCAACACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1455562-1461411	Sequence	Cphy_1155 - OB-fold tRNA/helicase-type nucleic acid binding-protein