Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 4160540
End position: 4160593
Length: 54

DNA sequence
>NC_010001, from 4160540 to 4160593 (54 bp); Clostridium phytofermentans ISDg GATTGTTCCTTCGTGAAGGATTGTTCCTTCGTGAAGGATTGTTCCTTCGTGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4159229-4161427	Sequence	Cphy_3399 - hypothetical protein (Protein is coded in complementary strand; from 4161427 to 4159229)