Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3921760
End position: 3921813
Length: 54

DNA sequence
>NC_010001, from 3921760 to 3921813 (54 bp); Clostridium phytofermentans ISDg GGTTATCTTTCTATAAGATGTTATCTCACTATAAGACGTTATCTCTCTTTAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3921799-3923274	Sequence	Cphy_3217 - glycoside hydrolase family protein (Protein is coded in complementary strand; from 3923274 to 3921799)