Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3901006
End position: 3901059
Length: 54

DNA sequence
>NC_010001, from 3901006 to 3901059 (54 bp); Clostridium phytofermentans ISDg ATCATGTTCTCTTTCTGCAGCATGTTCTTTTACTGCATCATGTTCTTTTCCTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3900878-3904963	Sequence	Cphy_3203 - hypothetical protein (Protein is coded in complementary strand; from 3904963 to 3900878)