Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3898828
End position: 3898881
Length: 54

DNA sequence
>NC_010001, from 3898828 to 3898881 (54 bp); Clostridium phytofermentans ISDg CGGTTGGTGTTGGCGTCGCTGTTGGTGTTGGTGTCGCCGTTGGTGTTGGTGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3898410-3900641	Sequence	Cphy_3202 - cellulase (Protein is coded in complementary strand; from 3900641 to 3898410)