Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3740808
End position: 3740861
Length: 54

DNA sequence
>NC_010001, from 3740808 to 3740861 (54 bp); Clostridium phytofermentans ISDg TTTTTTCTTATGTATCTATATTTTCCTAAGTATCTATATTTTCCTAAGTATCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3740860-3741432	Sequence	Cphy_3058 - hypothetical protein (Protein is coded in complementary strand; from 3741432 to 3740860)