Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3684761
End position: 3684814
Length: 54

DNA sequence
>NC_010001, from 3684761 to 3684814 (54 bp); Clostridium phytofermentans ISDg TTATGATCGTGGTGATCGTGATGATCGTGATGATCGTGGTGATCGTGATGATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3684713-3686032	Sequence	Cphy_3017 - dinitrogenase iron-molybdenum cofactor biosynthesis protein (Protein is coded in complementary strand; from 3686032 to 3684713)