Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3229395
End position: 3229448
Length: 54

DNA sequence
>NC_010001, from 3229395 to 3229448 (54 bp); Clostridium phytofermentans ISDg TCTTTTAAAGTACTTTCTTCTTTTAAAGTACTTTCTTCTTTTAACGCACTATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3228999-3230090	Sequence	Cphy_2643 - microcompartments protein (Protein is coded in complementary strand; from 3230090 to 3228999)