Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 2175428
End position: 2175481
Length: 54

DNA sequence
>NC_010001, from 2175428 to 2175481 (54 bp); Clostridium phytofermentans ISDg ACAAACAAAGTACTGTAGACAAACAAAGTAGTGCAAATAAACAAAGTAATGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2173688-2175943	Sequence	Cphy_1768 - PTS system, glucose subfamily, IIA subunit