Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 1139305
End position: 1139358
Length: 54

DNA sequence
>NC_010001, from 1139305 to 1139358 (54 bp); Clostridium phytofermentans ISDg TGCATGTTATTCATTCCTTGCATGTTATTCATTCCTTGCATATTATTCATTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1138603-1139820	Sequence	Cphy_0888 - hypothetical protein (Protein is coded in complementary strand; from 1139820 to 1138603)