Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 1113443
End position: 1113496
Length: 54

DNA sequence
>NC_010001, from 1113443 to 1113496 (54 bp); Clostridium phytofermentans ISDg AAAGAAAGTTCAAATAGTAAAGATGGTTCAAATAATAAAGAAAGCTCAATTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1113087-1115621	Sequence	Cphy_0868 - integral membrane sensor signal transduction histidine kinase