Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 1060604
End position: 1060657
Length: 54

DNA sequence
>NC_010001, from 1060604 to 1060657 (54 bp); Clostridium phytofermentans ISDg AGGAGTACTAGTTGGAACAGGAGTACTAGTTGGAAAAGGAGTACTTGTTGGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1060164-1061153	Sequence	Cphy_0830 - redoxin domain-containing protein (Protein is coded in complementary strand; from 1061153 to 1060164)