Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 2703102
End position: 2703152
Length: 51

DNA sequence
>NC_010001, from 2703102 to 2703152 (51 bp); Clostridium phytofermentans ISDg TAACACGTTATACCAATAAACATGTTATACCAATAAACACGTTATATTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2702785-2703105	Sequence	Cphy_2188 - hypothetical protein
ORF... 2703144-2704676	Sequence	Cphy_2189 - glutaredoxin (Protein is coded in complementary strand; from 2704676 to 2703144)