Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 923218
End position: 923262
Length: 45

DNA sequence
>NC_010001, from 923218 to 923262 (45 bp); Clostridium phytofermentans ISDg TAAAAATTCTTGATCTAAAAACTCTTGAACTAAAAACTCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 922139-924019	Sequence	Cphy_0711 - glycoside hydrolase family protein (Protein is coded in complementary strand; from 924019 to 922139)