Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 4203736
End position: 4203780
Length: 45

DNA sequence
>NC_010001, from 4203736 to 4203780 (45 bp); Clostridium phytofermentans ISDg TGTTCTCCATCTGATTGTTCTCCATCTGATTGTTCTCCGTCTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4202806-4206939	Sequence	Cphy_3423 - recombination helicase AddA (Protein is coded in complementary strand; from 4206939 to 4202806)