Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 4125883
End position: 4125927
Length: 45

DNA sequence
>NC_010001, from 4125883 to 4125927 (45 bp); Clostridium phytofermentans ISDg AGTATTAGGGGATTTAGTATTATTGGCTTTAGTAGTATTGGATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4124135-4126075	Sequence	Cphy_3379 - ABC transporter (Protein is coded in complementary strand; from 4126075 to 4124135)