Sequence retrieval

Genome: Clostridium phytofermentans ISDg
Start position: 3961601
End position: 3961645
Length: 45

DNA sequence
>NC_010001, from 3961601 to 3961645 (45 bp); Clostridium phytofermentans ISDg TTTATTATTTCTTACTTTATTATCTCTTAATTCTTTAGTTCTTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3961410-3963032	Sequence	Cphy_3257 - hypothetical protein (Protein is coded in complementary strand; from 3963032 to 3961410)